If you have been reading about clinical endpoint and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Updated 2026-03-02. Numbers and descriptions here follow the published literature rather than marketing material.
Thymosin alpha 1 was identified in 1977 as a component of thymosin fraction 5, a heterogeneous preparation used in early studies of thymic function. Investigators purified the active material and determined its amino acid sequence, which enabled chemical synthesis. Work in the following decades concentrated on T-cell maturation and immune reconstitution in animals and small human cohorts. Early preparations varied in composition, so results from that period are difficult to compare with studies using defined synthetic peptide.
Clinical research has examined the peptide in chronic hepatitis B and C, as a vaccine adjuvant, and in sepsis and oncology settings. Findings across trials are mixed; some report changes in selected immune markers, while others find no clear clinical benefit. Many studies are small and define outcomes differently, which limits comparison. Regulatory approval is confined to a few countries, and the compound is not an approved drug in the United States or most of Europe.
Overall evidence quality varies considerably. A large share of published reports come from single centers, rely on surrogate immunological markers, or lack adequate control groups. Systematic reviews have highlighted this heterogeneity as a barrier to pooling results. Open questions include which patients, if any, might benefit, what treatment duration is appropriate, and whether any effect is independent of standard care. The peptide is often described as an immune modulator rather than a therapy for one disease, which complicates confirmatory trial design.
Lyophilized thymosin alpha 1 is typically stored refrigerated at 2 to 8 degrees Celsius and kept away from light. Reconstituted solutions are less stable and are usually used promptly after preparation. Repeated freeze-thaw cycles are avoided because they can promote aggregation and loss of activity. The peptide adsorbs to some plastic and glass surfaces, so a carrier protein is often added to dilute working solutions. Manufacturer instructions and published protocols both govern handling.
Identity and purity testing for thymosin alpha 1 relies mainly on reversed-phase high-performance liquid chromatography and mass spectrometry. Chromatography separates the parent peptide from truncated or modified variants, while mass spectrometry confirms the expected molecular mass. Amino acid analysis and peptide mapping provide additional sequence confirmation. Counterion content, water content, and residual solvents are measured separately as part of specification testing. No single method captures every attribute, so laboratories combine several techniques.
The peptide lacks cysteine, methionine, and tryptophan, so disulfide scrambling and sulfur oxidation are not major degradation routes. Instead, aspartate residues can undergo isomerization or cyclization to succinimide intermediates, generating isoaspartate variants. Hydrolysis of peptide bonds also occurs slowly in solution. These changes may reduce biological activity even when the main peak remains detectable. Stability studies therefore track both potency and the appearance of related substances.
| Property | Value | Notes |
|---|---|---|
| First described | 1977 | Reported as a component of thymosin fraction 5 |
| Sequence length | 28 amino acids | N-terminal residue is acetylated |
| Net charge at neutral pH | Negative | Reflects a high proportion of acidic residues |
| Principal studied uses | Chronic hepatitis B and vaccine adjuvant | Research uses outnumber approved indications |
| Regulatory status | Approved in a limited number of countries | Not approved in the United States or most of Europe |
Root canal is also a colloquial term for a dental operation, endodontic therapy, wherein the pulp is cleaned out, the space disinfected and then filled. When rotary nickel titanium (NiTi) files are used in canals with flat-oval or tear-shaped cross sections, a circular bore is created due to the rotational action of the metal. Also, small cavities within the canal such as the buccal or lingual recesses may not be instrumented within the tooth, potentially leaving residual disease during disinfection. Tissue or biofilm remnants along such un-instrumented recesses may lead to failure due to both inadequate disinfection and the inability to properly obturate the root-canal space. Consequently, the biofilm should be removed with a disinfectant, commonly sodium hypochlorite, during root canal treatment.
Clinically, venom of this snake does not usually cause local effects at the bite site and is usually painless. However, the etiology progresses to systemic neurotoxic and myalgic symptoms, with frequent kidney failure accompanied by acute tubular necrosis. The huge area of distribution, potent venom in fairly large quantities and a definite willingness to defend themselves are important factors in their dangerousness. In Brazil and probably also in other countries in their area of distribution, this species is probably the most dangerous rattlesnake. After the fer-de-lance (Bothrops asper), it is the most common cause of snake envenoming. In the first half of the 20th century as well as in the 1950s and 1960s, 12% of treated cases ended fatally. Untreated cases apparently had a mortality rate of 72% in the same period, but this was due to the fact that there was no antivenom, poor medical care and neglect (Rosenfeld, 1971). In more recent times, an average of 20,000 snakebites are registered each year in Brazil, almost 10% of them caused by the neotropical rattlesnake. The mortality rate is estimated at 3.3% and is thus much lower than in the past (Ribeiro, 1990b). A study from southeastern Brazil documented only one fatality from 87 treated cases (Silveira and Nishioka, 1992).
Low-carbohydrate diets restrict carbohydrate consumption relative to the average diet. Foods high in carbohydrates (e.g., sugar, bread, pasta) are limited, and replaced with foods containing a higher percentage of fat and protein (e.g., meat, poultry, fish, shellfish, eggs, cheese, nuts, and seeds), as well as low carbohydrate foods (e.g. spinach, kale, chard, collards, and other fibrous vegetables). There is a lack of standardization of how much carbohydrate low-carbohydrate diets must have, and this has complicated research. One definition, from the American Academy of Family Physicians, specifies low-carbohydrate diets as having less than 20% of calories from carbohydrates. There is no good evidence that low-carbohydrate dieting in general confers any particular health benefits apart from weight loss, where low-carbohydrate diets achieve outcomes similar to other diets, as weight loss is mainly determined by calorie restriction and adherence. One particular form of low-carbohydrate diet called the ketogenic diet was first established as a medical diet for treating epilepsy. It became a popular diet for weight loss through celebrity endorsement, but there is no evidence of any distinctive benefit for this purpose and the diet carries a risk of adverse effects, with the British Dietetic Association naming it one of the "top five worst celeb diets to avoid" in 2018.
Sources: en.wikipedia.org
In Australia, local soccer clubs, competitions and associations were mostly established independently and later affiliated with regional and states and territory bodies. A federated model of national, states and territories bodies developed since the first state body was established in New South Wales in 1882. Today, there is FA, the professional leagues, nine state and territory member federations and over 100 district, regional and local zones and associations.
==== Other pain ==== Paracetamol fails to relieve procedural pain in newborn babies. For perineal pain postpartum paracetamol appears to be less effective than nonsteroidal anti-inflammatory drugs (NSAIDs). The studies to support or refute the use of paracetamol for cancer pain and neuropathic pain are lacking. There is limited evidence in favor of the use of the intravenous form of paracetamol for acute pain control in the emergency department. The combination of paracetamol with caffeine is superior to paracetamol alone for the treatment of acute pain.
In Figure 5, both ribosomal subunits (small and large) assemble at the start codon (towards the 5' end of the mRNA). The ribosome uses tRNA that matches the current codon (triplet) on the mRNA to append an amino acid to the polypeptide chain. This is done for each triplet on the mRNA, while the ribosome moves towards the 3' end of the mRNA. Usually in bacterial cells, several ribosomes are working parallel on a single mRNA, forming what is called a polyribosome or polysome.
Sources: en.wikipedia.org
Low-carbohydrate diets may miss the health advantages – such as increased intake of dietary fiber and phytochemicals – afforded by high-quality plant foods such as legumes and pulses, whole grains, fruits, and vegetables. A "meta-analysis, of moderate quality," included as adverse effects of the diet halitosis, headache and constipation. Carbohydrate-restricted diets can be as effective as low-fat diets in helping achieve weight loss over the short term when overall calorie intake is reduced. An Endocrine Society scientific statement said that "when calorie intake is held constant [...] body-fat accumulation does not appear to be affected by even very pronounced changes in the amount of fat vs carbohydrate in the diet." In the long term, low-carbohydrate diets do not appear to confer a "metabolic advantage," and effective weight loss or maintenance depends on the level of calorie restriction, not the ratio of macronutrients in a diet. The reasoning of diet advocates that carbohydrates cause undue fat accumulation by increasing blood insulin levels, but a more balanced diet that restricts refined carbohydrates can also reduce serum glucose and insulin levels and may also suppress lipogenesis and promote fat oxidation. However, as far as energy expenditure itself is concerned, the claim that low-carbohydrate diets have a "metabolic advantage" is not supported by clinical evidence.
Democratic Senator Elizabeth Warren, the ranking member on the Senate Banking Committee, also expressed support for blocking any future Trump Federal Reserve nominations in response to the investigation. Republican Senators Kevin Cramer, John Kennedy, and Dave McCormick expressed skepticism that Powell was guilty of criminal activity, while House Financial Services Committee Chair French Hill and Republican Senator Roger Marshall criticized the investigation as a distraction. However, Cramer later suggested that Powell should resign to have the investigation dropped and prevent an indictment. Senate Banking Committee Chair Tim Scott initially provided no comment when asked about the investigation by reporters; Scott presided over the Senate Banking Committee meeting where Powell provided testimony that has become the subject of the perjury investigation. Scott subsequently said that he does not believe Powell perjured himself during his testimony. Senate Majority Leader John Thune called for the investigation to be resolved quickly, for it to not interfere with the Federal Reserve's independence, and asserted that the allegations against Powell "better be real and they better be serious" or otherwise more senators may likewise support blocking future Trump Federal Reserve nominations. Speaker of the House Mike Johnson rejected assertions that the Justice Department was being weaponized in conducting the investigation, expressed no opinion about the allegations, and downplayed concerns that the investigation would undermine the Federal Reserve's independence.
== Derived units and SI multiples == The only SI derived unit with a special name derived from the mole is the katal, defined as one mole per second of catalytic activity. Like other SI units, the mole can also be modified by adding a metric prefix that multiplies it by a power of 10:
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Sources: en.wikipedia.org
Trials differ in patient population, dose schedule, background treatment, and the endpoints used to judge success. Many are small and single-center, so random variation can dominate the reported effects.
Authorization is limited to a small number of countries and covers specific indications such as chronic hepatitis B and vaccine adjuvant use. Availability and labelling differ by jurisdiction.
Most reviews describe it as an immunomodulatory agent with an uncertain clinical effect. They generally call for larger, better-controlled trials before firm conclusions are drawn.
The lyophilized powder is kept refrigerated at 2 to 8 degrees Celsius and protected from light. Reconstituted solutions should be used promptly. Freezing and thawing repeatedly is avoided.